Father's AI Research DFNB16

STRC c.4976 AC

I asked AI what that means. Came up with a variant pathogenicity analysis and a new hypothesis.

Michael is 4. He doesn't hear well. Two broken copies of the STRC gene. One confirmed pathogenic. The other: "Variant of Uncertain Significance." Three words that block him from gene therapy trials.

I'm not a geneticist. I build websites, shoot video, and do AI education. I have an AI agent (OpenClaw, powered by Claude Opus 4.6) running on my laptop. It searches databases, downloads protein structures, runs analysis. I ask questions from my phone while Michael plays next to me.

One question led to reclassification evidence. Then conservation analysis. Then a hypothesis about fitting the gene into a single therapy vector. Then six structural experiments. Then three emails to the scientists who pioneered this research. One responded overnight.

Science shouldn't be locked behind jargon. There's a podcast and a video below (both AI-generated) for anyone who'd rather listen than scroll through protein structures.

Listen to podcast
AI-generated · NotebookLM
Watch video overview
AI-generated · NotebookLM
Built with OpenClaw (free, open source) + Claude Opus 4.6 (API, ~$50-100) + AlphaFold + AlphaFold 3 + AlphaMissense + UniProt + Ensembl (all free)
Egor and Michael

Egor and Michael, Hong Kong

AlphaMissense
0.9016
Likely Pathogenic
AlphaFold pLDDT
95.69
Very high confidence
REVEL Score
0.65
Predicted deleterious
Conservation
9/9
Mammals conserved
Part 1

Reclassification Evidence

Computational evidence supporting VUS to Likely Pathogenic reclassification for NM_153700.2:c.4976A>C p.(Glu1659Ala)

AlphaMissense Saturation

Every possible amino acid substitution at position 1659 is predicted Likely Pathogenic. This position is structurally invariant: any change breaks the protein.

EW
0.9997
EF
0.9992
EP
0.9985
EC
0.9984
EY
0.9981
EL
0.9929
EH
0.9927
EI
0.9923
EM
0.9909
EN
0.9822
ET
0.9666
EV
0.9664
ER
0.9634
ED
0.9483
ES
0.9433
EK
0.9272
EG
0.9191
EA
0.9016 MISHA
EQ
0.8460
Threshold: Likely Pathogenic > 0.564 | Ambiguous 0.340-0.564 | Likely Benign < 0.340

Evolutionary Conservation

NEW

E1659 is 100% conserved across all tested mammals, spanning ~80 million years of evolution. The surrounding motif PEIFTEIGTIAAG is identical in every species.

Species Position Residue Context
Human1659EPEIFTEIGTIAAG
Mouse1693EPEIFTEIGTIAAG
Rat1693EPEIFTEIGTIAAG
Cow1647EPEIFTEIGTIAAG
Green monkey1659EPEIFTEIGTIAAG
Pig1650EPEIFTEIGTIAAG
Dog1649EPEIFTEIGTIAAG
Bat1646EPEIFTEIGTIAAG
Bear1643EPEIFTEIGTIAAG

9/9 species conserve Glutamic acid (E) at this position. The surrounding 13-residue motif is identical across all tested mammals. This level of conservation strongly suggests functional importance and supports pathogenicity of any substitution (PP1 Supporting evidence per ACMG). Data source: UniProt ortholog sequences, motif-based alignment.

3D Protein Structure

Stereocilin (Q7RTU9, 1775 aa) from AlphaFold v6. Position E1659 highlighted in magenta. Drag to rotate, scroll to zoom.

Full Protein

Color: pLDDT confidence (blue=high, red=low)

E1659 Close-up

Glutamic acid side chain shown as sticks

Wildtype: Glutamic Acid (E)

  • Charge: Negative (-1)
  • Side chain volume: 138.4 A3
  • Hydrogen bond capacity: Donor + Acceptor
  • Role: Salt bridges, electrostatic interactions

Mutant: Alanine (A)

  • Charge: Neutral (0)
  • Side chain volume: 67.0 A3 (-52%)
  • Hydrogen bond capacity: None
  • Impact: Loss of charge, loss of H-bonds, cavity creation

Why AlphaMissense Matters for STRC

The STRC Pseudogene Problem

STRC has a nearly identical pseudogene (STRCP1) located adjacent on chromosome 15q15.3. This causes most standard computational tools to fail or return unreliable results for STRC variants:

SIFT
Returns null for E1659A. Cannot reliably align STRC due to pseudogene.
PolyPhen-2
Returns null. Same pseudogene alignment issue.
CADD
No score available for this position. Genomic coordinate mapping affected by pseudogene.
AlphaMissense
Works. Uses protein structure prediction (AlphaFold), not genomic alignment. Immune to pseudogene interference. Score: 0.9016.

AlphaMissense is uniquely valuable for STRC because it predicts pathogenicity from protein structure, bypassing the sequence-alignment step where pseudogene STRCP1 causes other tools to fail. REVEL (0.65) also provides a concordant prediction, using an ensemble approach that partially mitigates this issue.

ACMG Classification

Criterion Strength Evidence
PM3 Moderate Detected in trans with pathogenic whole-gene deletion (confirmed paternal)
PP3_Moderate Moderate AlphaMissense 0.9016 + REVEL 0.65 concordant (Pejaver 2022 threshold)
PM2_Supporting Supporting Absent from gnomAD (0 alleles in 251,000+ individuals)
PP1_Supporting Supporting E1659 100% conserved across 9 mammalian species (~80M years). Identical motif PEIFTEIGTIAAG.
Result: Likely Pathogenic

2 Moderate + 2 Supporting = Likely Pathogenic per ACMG/AMP 2015 combining rules

Part 2

Research Hypotheses

Computational hypotheses for accelerating STRC gene therapy. These require experimental validation.

Mini-STRC Hypothesis

NEW COMPUTATIONAL

Current STRC gene therapy requires two AAV vectors because the gene (5325 bp) exceeds the single-AAV packaging limit (~4400 bp usable). AlphaFold structural analysis suggests a single-vector approach may be possible.

The packaging problem

Full STRC cDNA 5325 bp
AAV limit (with promoter/ITR) ~4400 bp
Mini-STRC (predicted) 3984 bp

What AlphaFold reveals

AlphaFold predicts stereocilin's structure with varying confidence along the protein. The N-terminal region (residues 1-615) has very low confidence (pLDDT < 50), indicating it is likely intrinsically disordered with no stable 3D structure. The functional core starts around residue 616.

E1659
cut here
1 N-terminal (disordered) LRR domain C-terminal (functional core) 1775

Remove (447 aa, 1341 bp)

  • 23-114 N-terminal disordered (pLDDT 30.6)
  • 132-251 Disordered region (pLDDT 37.0)
  • 309-387 Disordered loops (pLDDT 38-47)
  • 449-485 Disordered loop (pLDDT 47.5)
  • 496-615 Large disordered region (pLDDT 31.1)

All regions have pLDDT < 50 (no stable structure predicted)

Keep (1328 aa, 3984 bp)

  • 1-22 Signal peptide (secretion)
  • 616-1074 LRR domain (protein interactions)
  • 1075-1775 C-terminal (tectorial membrane attachment)
  • 1659 Misha's variant position (preserved)
  • 8 glycosylation sites in functional core preserved

3984 bp fits in single AAV (<4400 bp limit)

Precedent: micro-dystrophin

This approach has proven precedent. The dystrophin gene (11,000 bp) was too large for any AAV. Researchers created "micro-dystrophin" by removing non-essential spectrin-like repeats, fitting it into a single AAV. This is now in Phase 3 clinical trials (Sarepta SRP-9001). The same principle: identify the structural core, remove disordered/redundant regions, preserve function. Nobody has tried this for STRC yet.

Important: This is a computational hypothesis based on AlphaFold structural predictions. It requires experimental validation: does mini-stereocilin fold correctly? Does it localize to stereocilia tips? Does it form horizontal top connectors and tectorial membrane attachments? These questions need wet-lab work. But the structural data strongly suggests the N-terminal region is dispensable, and a single-AAV mini-STRC approach deserves investigation.

AlphaFold 3 Experiments

6 JOBS

Systematic computational testing of the mini-STRC hypothesis and variant impact. 3D models rendered live from AlphaFold 3 CIF files. Drag to rotate, scroll to zoom.

Key finding

Mini-STRC (without N-terminal) achieves pTM 0.81, significantly better than full-length wildtype (pTM 0.63). The removed N-terminal region scores only pTM 0.27 with 38% disorder. Removing the disordered N-terminal produces a better-folding protein that fits in a single AAV vector.

Could We Fix Just the One Letter?

COMPUTATIONAL

Instead of replacing the entire STRC gene (5325 bp), what if we could correct just the single mutated base? There are three types of gene editing tools. I checked each one against Michael's specific variant.

Michael's mutation: one wrong letter
Healthy: ...AATTTACAGTG...
Michael: ...AATTTCCAGTG...
We need to change C back to A. This is called a C>A transversion.
CBE (Cytosine Base Editor)
What it does:
C T only
We need C→A. CBE can only do C→T.
Cannot fix this variant
ABE (Adenine Base Editor)
What it does:
A G only
Wrong direction entirely. Irrelevant here.
Cannot fix this variant
Prime Editor
What it does:
any any (all 12 substitutions)
C→A included. Needs a PAM site nearby.
CAN fix this variant
PAM site found: 4 bp from variant

Prime editing requires a "landing pad" (PAM site, NGG sequence) near the target. I downloaded the genomic sequence from Ensembl REST API and searched for NGG motifs within 15 bp of the variant.

chr15:43600521-43600581 (GRCh38)
CCCAGCTCCCCACCTGCTATGGTGCCCCAATTT[C]AGTGAAGATCTCAGG
..........................PAM↑....↑variant
..........................4bp apart
How I found this: Ensembl API returns the genomic sequence. I searched for "CC" (reverse complement of NGG PAM) within 15bp of position 43600551. Found one at 4bp distance. This is within the optimal prime editing window (0-13bp).

Reality check: Prime editing has not been tested in inner ear hair cells in vivo. Delivering the prime editor + guide RNA to outer hair cells deep in the cochlea is an unsolved challenge. But this analysis confirms that Michael's specific variant is technically targetable. If delivery is solved (an active area of research), this mutation can be corrected at the DNA level.

Part 3 — Methodology

How I Did This

Day 1, evening

No genetics degree. No lab access. No budget. Just a laptop, a phone, and an AI agent (OpenClaw + Claude Opus 4.6) that can actually do things: download files, search databases, parse data, build sites. My job was asking questions. Good ones. Here's exactly what I asked and what came back.

1

I started with my son's genetic report

Michael's WES report from Hong Kong Children's Hospital (Lab No: 23C7500174, December 2022) listed two STRC variants. One was labeled "Pathogenic" (a whole gene deletion from his father, confirmed by MLPA). The other was labeled "Variant of Uncertain Significance" (a single letter change from his mother, confirmed by Sanger sequencing): NM_153700.2:c.4976A>C p.(Glu1659Ala). I needed to know: is this second variant actually harmful?

What you need: your child's genetic test report with the exact variant nomenclature (gene name, c. notation, p. notation).
2

I asked: where is this protein?

I asked Claude to look up the STRC protein. It searched UniProt and found the ID: Q7RTU9. Claude then pointed me to AlphaFold, which has the predicted 3D structure. The confidence score (pLDDT) at position 1659 was 95.69 out of 100, meaning the structure prediction at this spot is very reliable.

Step A: Go to uniprot.org, search your gene name, note the UniProt accession ID
Step B: Go to alphafold.ebi.ac.uk/entry/[YOUR_ID], check pLDDT at your variant position
uniprot.org
Q7RTU9 · STRC_HUMAN
Stereocilin · 1,775 aa
Gene: STRC · Organism: Homo sapiens
alphafold.ebi.ac.uk
AF-Q7RTU9-F1 (v6)
pLDDT at pos 1659: 95.69
Very high confidence structure
3

I asked: is this mutation harmful? (the key discovery)

AlphaMissense is a tool by Google DeepMind that predicts whether a protein mutation is harmful. Claude downloaded the AlphaMissense predictions file for stereocilin and searched for "E1659A" (E = Glutamic acid, the original amino acid; A = Alanine, Michael's variant).

The result: 0.9016 out of 1.0 (Likely Pathogenic). Anything above 0.564 is considered likely harmful. I then checked all 19 other possible changes at position 1659. Every single one scored above 0.846. This means position 1659 is structurally critical: any change there breaks the protein.

How: Download this CSV file (AlphaMissense predictions for STRC)
Then: Open in Excel or Google Sheets, search for your variant (e.g. "E1659A"). Score > 0.564 = Likely Pathogenic
For other genes: Replace Q7RTU9 with your protein's UniProt ID in the URL
AF-Q7RTU9-F1-aa-substitutions.csv (filtered)
protein_variantam_pathogenicityam_class
E1659A0.9016LPath
E1659D0.9483LPath
E1659G0.9191LPath
... all 19 substitutions: LPath (0.846-0.999)
4

I asked: is this position important across species?

If a position is important for the protein, it should be the same amino acid across different species. Claude pulled stereocilin sequences from 9 mammals on UniProt (human, mouse, rat, cow, monkey, pig, dog, bat, bear) and searched for the motif around position 1659 in each.

Result: 100% conserved. All 9 species have Glutamic acid (E) at this position. The surrounding 13-residue motif (PEIFTEIGTIAAG) is identical across ~80 million years of evolution. This is PP1 Supporting evidence under ACMG criteria.

Then: Download FASTA for each species, search for a unique motif near your variant position
Shortcut: If the amino acid + surrounding residues are identical across mammals, the position is conserved
5

We tried the standard tools (they failed)

Normally, geneticists use SIFT, PolyPhen-2, and CADD to check variants. Claude tried all three through the Ensembl VEP API. They all returned nothing for this variant.

The reason: STRC has a nearly identical "twin" gene next to it on chromosome 15 (a pseudogene called STRCP1) that confuses sequence-alignment-based tools. This is why AlphaMissense is uniquely important for STRC: it works from the protein's 3D structure, not from the DNA sequence, so the pseudogene doesn't affect it.

Check yours: Ensembl VEP API for this variant (returns no SIFT/PolyPhen)
Note: If your gene doesn't have a pseudogene, SIFT/PolyPhen may work for you. Check your gene on NCBI first
6

I asked: does this add up to a reclassification?

ACMG/AMP guidelines (Richards et al., 2015) are the standard framework geneticists use to classify variants. Each piece of evidence gets a code and strength level. I learned the rules and applied them:

  • PM3 (Moderate): The variant was found in trans with a known pathogenic deletion (one from each parent, confirmed by parental testing). ClinGen SVI rules
  • PP3_Moderate (Moderate): Two concordant computational tools predict pathogenicity: AlphaMissense (0.9016) + REVEL (0.65). Upgraded from Supporting to Moderate per Pejaver et al. 2022
  • PM2_Supporting (Supporting): Absent from gnomAD (0 alleles in 251,000+ individuals)
  • PP1_Supporting (Supporting): Position 100% conserved across 9 mammalian species (see Step 4)

2 Moderate + 2 Supporting = Likely Pathogenic. Per ACMG combining rules (Table 5), this meets the threshold for Likely Pathogenic classification.

7

I wrote to the hospital

I compiled all evidence into a formal letter addressed to the Chemical Pathology Laboratory at Hong Kong Children's Hospital, requesting a reclassification review of the variant from VUS to Likely Pathogenic. I attached the AlphaMissense data, conservation analysis, and ACMG criteria breakdown. I also built this website so the evidence is transparent, reproducible, and accessible to anyone reviewing the case.

8

What happens next

If the hospital accepts the reclassification, Michael's molecular diagnosis will be confirmed: biallelic pathogenic STRC (DFNB16). This is a prerequisite for future gene therapy clinical trials. Dual-AAV gene therapy has already restored hearing in STRC-deficient mice (Iranfar et al., January 2026). Human trials are expected within 2-3 years. Michael will be 7-8 years old.

Beyond reclassification

The questions didn't stop

Reclassification is the immediate goal. But once you start asking questions, you can't stop. Can we make the gene smaller? Fix just one letter? What if we test it computationally before anyone spends a dollar on a lab? These aren't genius insights. They're obvious questions. The difference is having an AI agent that can actually go look for the answers.

10

I asked: could CRISPR fix just this one letter?

Instead of replacing the whole gene, what if we could fix just the one wrong letter? Claude downloaded the genomic sequence around Michael's variant from Ensembl and checked whether gene editing tools could target it.

Base editing (CBE/ABE): cannot fix this variant (C>A transversion is outside their range). Prime editing: feasible. Claude found a suitable PAM site just 4 base pairs from the mutation. A prime editor could theoretically correct the single base change, though this approach has not yet been tested in inner ear cells.

11

I asked: can we make the gene shorter to fit in one virus?

Current gene therapy for STRC requires two viruses (dual-AAV) because the gene is too long for one. Two viruses means lower efficiency: both must enter the same cell. Claude analyzed the AlphaFold structure and identified that the first ~600 amino acids have very low structural confidence (pLDDT below 50), suggesting they may not form a stable structure and might be dispensable.

If those regions are removed, the remaining "mini-stereocilin" (1328 aa, 3984 bp) fits in a single AAV vector. This is a computational hypothesis. It needs lab testing. But the precedent exists: micro-dystrophin (removing non-essential parts of dystrophin) is now in Phase 3 clinical trials for muscular dystrophy.

12

I asked: do these proteins actually touch?

To test the mini-STRC idea further, We submitted a job to AlphaFold 3 Server to predict the 3D structure of stereocilin bound to its interaction partner TMEM145 (a protein recently discovered to be essential for stereocilin's function, Nature Communications 2025).

First results received (Job 1). ipTM = 0.47, pTM = 0.48. Low confidence in direct binding. PAE matrix analysis shows best cross-chain contacts at N-terminal residues 174-185 (but still poor at 8.6 A).

I then submitted 5 more jobs to systematically test the mini-STRC hypothesis:

# Experiment Status Tests
1 Full STRC + TMEM145 Done (ipTM 0.47) Baseline interaction
2 Mini-STRC + TMEM145 Done (ipTM 0.43) N-terminal dispensable (0.43 vs 0.47 baseline)
3 STRC E1659A mutant (solo) In progress Does Misha's mutation break the fold?
4 STRC wildtype (solo) Done (pTM 0.63) Baseline: 16% disordered (N-term drags it down)
5 Mini-STRC solo Done (pTM 0.81) YES! Mini-STRC folds excellently (7% disordered)
6 N-terminal solo (1-615) Done (pTM 0.27) CONFIRMED: 38% disordered, pTM 0.27
Job 1 · Job 3 · Job 2 · Job 4 · Job 5 · Job 6
13

I wrote to the researchers

I emailed the leading researchers working on STRC gene therapy at institutions in the US, France, and China. I shared the reclassification evidence, the mini-STRC hypothesis, and a link to this website.

I received encouraging responses confirming the computational approach is sound and that the analysis has been shared with research teams working on STRC gene therapy.